LDB3 protein-altering variants in ExAC


The table below lists the LDB3 protein-altering variants found in the ExAC population database with a mean allelic frequency (MAF) less than 0.0001, classified for this study as a rare variant. Click on each variant for more details, including presence in the 1000 Genomes and Exome Sequencing Project databases, a breakdown by ethnic class and the variant's role in inherited cardiac disease. Use the form below to customise the variant selection. The table can be sorted by variant location, variant type or ExAC frequency.




No. Genomic coord. Variant (CDS) Variant (Protein) Variant Type ExAC frequencyPopulations*
1. 88476492 c.1640G>A p.R547Q missense 0.00009751
2. 88466427 c.1036G>A p.A346T missense 0.00009476
3. 88466383 c.992C>T p.A331V missense 0.00009239
4. 88476282 c.1430A>G p.Y477C missense 0.00009100
5. 88477867 c.1823C>T p.P608L missense 0.00009061
6. 88441421 c.550A>G p.K184E missense 0.00008435
7. 88476164 c.1312A>G p.T438A missense 0.00008327
8. 88476263 c.1411C>T p.P471S missense 0.00008286
9. 88476294 c.1442C>G p.P481R missense 0.00008270
10. 88476339 c.1487T>C p.F496S missense 0.00008264
11. 88476527 c.1675C>T p.R559W missense 0.00008256
12. 88441215 c.344G>A p.G115D missense 0.00007732
13. 88466346 c.955G>A p.A319T missense 0.00007544
14. 88476287 c.1435G>A p.G479R missense 0.00007445
15. 88476189 c.1337C>A p.T446N missense 0.00007335
16. 88466466 c.1075G>A p.D359N missense 0.00006983
17. 88441397 c.526G>A p.G176R missense 0.00006840
18. 88441403 c.532C>G p.R178G missense 0.00006825
19. 88476491 c.1639C>T p.R547W missense 0.00006774
20. 88478536 c.1910C>T p.A637V missense 0.00006594
21. 88492699 c.2150T>G p.L717R missense 0.00006163
22. 88428539 c.91C>T p.R31W missense 0.00005898
23. 88441452 c.581A>T p.Q194L missense 0.00005846
24. 88451732 c.769G>C p.E257Q missense 0.00005771
25. 88478530 c.1904T>G p.V635G missense 0.00005769
26. 88441547 c.676G>A p.G226R missense 0.00005316
27. 88441527 c.656G>A p.R219Q missense 0.00005228
28. 88485965 c.2050G>A p.E684K missense 0.00004945
29. 88477842 c.1798C>T p.R600X nonsense 0.00004942
30. 88476506 c.1654G>A p.G552S missense 0.00004447
31. 88466392 c.1001C>A p.P334Q missense 0.00004202
32. 88466335 c.944C>T p.P315L missense 0.00004190
33. 88451687 c.724G>A p.A242T missense 0.00004123
34. 88439190 c.160G>A p.G54S missense 0.00004122
35. 88476165 c.1313C>A p.T438N missense 0.00003831
36. 88492723 c.2174T>C p.I725T missense 0.00003703
37. 88441539 c.668C>T p.S223L missense 0.00003519
38. 88441526 c.655C>T p.R219X nonsense 0.00003486
39. 88441340 c.469G>C p.E157Q missense 0.00003448
40. 88441269 c.398C>T p.P133L missense 0.00003433
41. 88441258 c.387_395delCCCAGGCAC p.Pro130_Thr132del inframe 0.00003433
42. 88441278 c.407C>T p.P136L missense 0.00003433
43. 88441404 c.533G>A p.R178Q missense 0.00003408
44. 88466409 c.1018G>C p.A340P missense 0.00003373
45. 88466296 c.905T>C p.I302T missense 0.00003355
46. 88428502 c.54G>T p.Q18H missense 0.00003337
47. 88478598 c.1972G>A p.E658K missense 0.00003311
48. 88476324 c.1472T>A p.V491E missense 0.00003305
49. 88478583 c.1957G>A p.G653R missense 0.00003303
50. 88439873 c.280C>A p.P94T missense 0.00003299
51. 88439865 c.272C>T p.T91M missense 0.00003299
52. 88485941 c.2026G>A p.V676M missense 0.00003296
53. 88477747 c.1703G>A p.R568H missense 0.00003296
54. 88477843 c.1799G>A p.R600Q missense 0.00003295
55. 88476528 c.1676G>A p.R559Q missense 0.00002780
56. 88492723 c.2174T>A p.I725N missense 0.00002778
57. 88441517 c.646A>T p.M216L missense 0.00002596
58. 88441365 c.494G>A p.R165Q missense 0.00002590
59. 88441209 c.338C>T p.T113M missense 0.00002577
60. 88441214 c.343G>C p.G115R missense 0.00002577
61. 88441283 c.412C>G p.L138V missense 0.00002574
62. 88441415 c.544G>A p.G182S missense 0.00002538
63. 88441479 c.608C>T p.S203L missense 0.00002530
64. 88466398 c.1007delT p.Leu336ArgfsTer156 frameshift 0.00002522
65. 88428461 c.13_14insTGACCC p.Val5_Thr6insThrLeu inframe 0.00002498
66. 88476255 c.1403A>G p.N468S missense 0.00002488
67. 88451808 c.845C>T p.T282M missense 0.00002486
68. 88476381 c.1529G>A p.S510N missense 0.00002482
69. 88476297 c.1445C>T p.A482V missense 0.00002481
70. 88476338 c.1486T>G p.F496V missense 0.00002479
71. 88476354 c.1502C>T p.A501V missense 0.00002479
72. 88451780 c.817C>T p.R273C missense 0.00002476
73. 88485989 c.2074G>A p.D692N missense 0.00002476
74. 88439846 c.253C>T p.R85C missense 0.00002474
75. 88477740 c.1696A>G p.M566V missense 0.00002473
76. 88439175 c.145G>A p.V49M missense 0.00002473
77. 88439175 c.145G>C p.V49L missense 0.00002473
78. 88477758 c.1714C>A p.P572T missense 0.00002472
79. 88452319 c.887G>A p.R296Q missense 0.00002471
80. 88477830 c.1786G>A p.V596I missense 0.00002471
81. 88476168 c.1316C>T p.P439L missense 0.00002106
82. 88476164 c.1312A>C p.T438P missense 0.00002082
83. 88476173 c.1321C>T p.P441S missense 0.00002011
84. 88476140 c.1288A>G p.T430A missense 0.00001807
85. 88469796 c.1220T>C p.V407A missense 0.00001765
86. 88492675 c.2126T>C p.F709S missense 0.00001763
87. 88492683 c.2134_2136delAAG p.Lys712del inframe 0.00001756
88. 88476141 c.1289C>T p.T430I missense 0.00001755
89. 88441362 c.491C>T p.P164L missense 0.00001731
90. 88441379 c.508G>A p.A170T missense 0.00001720
91. 88441322 c.451G>A p.A151T missense 0.00001719
92. 88441229 c.358C>A p.P120T missense 0.00001719
93. 88441239 c.368G>A p.S123N missense 0.00001718
94. 88441314 c.443G>A p.R148Q missense 0.00001718
95. 88441244 c.373G>A p.E125K missense 0.00001718
96. 88441266 c.395C>T p.T132I missense 0.00001718
97. 88441199 c.328G>A p.A110T missense 0.00001716
98. 88441293 c.422C>T p.T141I missense 0.00001714
99. 88441396 c.525G>C p.E175D missense 0.00001711
100. 88469691 c.1115T>C p.V372A missense 0.00001705
101. 88469706 c.1130C>T p.A377V missense 0.00001702
102. 88441486 c.615G>C p.E205D missense 0.00001695
103. 88441431 c.560C>A p.P187Q missense 0.00001682
104. 88466382 c.991G>A p.A331T missense 0.00001680
105. 88439915 c.321+1G>A essential splice site 0.00001679
106. 88466305 c.914C>A p.A305E missense 0.00001677
107. 88466331 c.940A>G p.T314A missense 0.00001676
108. 88476108 c.1256C>A p.S419Y missense 0.00001672
109. 88441446 c.575C>T p.P192L missense 0.00001672
110. 88476234 c.1382A>C p.Y461S missense 0.00001671
111. 88441453 c.582A>C p.Q194H missense 0.00001670
112. 88428504 c.56G>C p.G19A missense 0.00001668
113. 88428461 c.13G>A p.V5M missense 0.00001665
114. 88476398 c.1546C>T p.R516W missense 0.00001658
115. 88476399 c.1547G>A p.R516Q missense 0.00001658
116. 88477720 c.1677-1G>A essential splice site 0.00001655
117. 88476372 c.1520C>A p.T507N missense 0.00001654
118. 88476345 c.1493A>G p.Q498R missense 0.00001653
119. 88478583 c.1957G>C p.G653R missense 0.00001652
120. 88439889 c.296C>T p.P99L missense 0.00001652
121. 88451792 c.829A>T p.I277F missense 0.00001652
122. 88439874 c.281C>T p.P94L missense 0.00001650
123. 88439847 c.254G>A p.R85H missense 0.00001649
124. 88451676 c.713C>A p.A238D missense 0.00001649
125. 88451760 c.797G>A p.R266H missense 0.00001649
126. 88485915 c.2000C>T p.T667I missense 0.00001649
127. 88477888 c.1844C>G p.T615S missense 0.00001648
128. 88478511 c.1885T>C p.W629R missense 0.00001648
129. 88477833 c.1789T>A p.Y597N missense 0.00001647
130. 88476519 c.1667A>G p.N556S missense 0.00001248
131. 88476507 c.1655G>T p.G552V missense 0.00001116
132. 88476506 c.1654G>C p.G552R missense 0.00001112
133. 88476489 c.1637G>A p.S546N missense 0.00000957
134. 88466457 c.1066A>C p.S356R missense 0.00000933
135. 88492651 c.2102A>G p.H701R missense 0.00000928
136. 88492653 c.2104G>T p.V702L missense 0.00000923
137. 88476144 c.1292C>A p.P431H missense 0.00000905
138. 88476140 c.1288A>T p.T430S missense 0.00000903
139. 88492712 c.2163C>A p.H721Q missense 0.00000896
140. 88492666 c.2117G>T p.G706V missense 0.00000895
141. 88441561 c.689+1G>A essential splice site 0.00000893
142. 88492668 c.2119C>T p.Q707X nonsense 0.00000892
143. 88492705 c.2156A>C p.K719T missense 0.00000887
144. 88492672 c.2123C>T p.P708L missense 0.00000886
145. 88476473 c.1621C>T p.R541X nonsense 0.00000881
146. 88492680 c.2131T>G p.S711A missense 0.00000879
147. 88476141 c.1289C>A p.T430N missense 0.00000878
148. 88469786 c.1210C>G p.R404G missense 0.00000874
149. 88469786 c.1210C>T p.R404W missense 0.00000874
150. 88476213 c.1361C>T p.T454I missense 0.00000872
151. 88441367 c.496G>T p.A166S missense 0.00000863
152. 88469763 c.1187G>A p.R396Q missense 0.00000863
153. 88441343 c.472G>A p.A158T missense 0.00000862
154. 88441340 c.469G>A p.E157K missense 0.00000862
155. 88441343 c.472G>T p.A158S missense 0.00000862
156. 88441380 c.509C>T p.A170V missense 0.00000860
157. 88441506 c.635A>T p.Q212L missense 0.00000860
158. 88441248 c.377C>G p.A126G missense 0.00000859
159. 88441289 c.418C>G p.P140A missense 0.00000859
160. 88469736 c.1160G>T p.G387V missense 0.00000859
161. 88441384 c.513G>T p.K171N missense 0.00000859
162. 88441227 c.356C>T p.A119V missense 0.00000859
163. 88441268 c.397C>T p.P133S missense 0.00000858
164. 88469742 c.1166C>G p.A389G missense 0.00000858
165. 88441304 c.433G>T p.A145S missense 0.00000858
166. 88441286 c.415A>G p.R139G missense 0.00000858
167. 88441280 c.409G>A p.E137K missense 0.00000858
168. 88441299 c.428G>T p.S143I missense 0.00000857
169. 88441391 c.520C>T p.P174S missense 0.00000857
170. 88469729 c.1153A>G p.S385G missense 0.00000854
171. 88469728 c.1152C>A p.Y384X nonsense 0.00000854
172. 88441496 c.625G>C p.E209Q missense 0.00000853
173. 88469723 c.1147A>G p.S383G missense 0.00000853
174. 88441403 c.532C>T p.R178W missense 0.00000853
175. 88469696 c.1120G>A p.A374T missense 0.00000851
176. 88469709 c.1133C>T p.P378L missense 0.00000851
177. 88469670 c.1094C>T p.A365V missense 0.00000850
178. 88466418 c.1027A>G p.T343A missense 0.00000849
179. 88441490 c.619C>G p.L207V missense 0.00000849
180. 88476224 c.1372G>A p.A458T missense 0.00000846
181. 88441485 c.614A>C p.E205A missense 0.00000846
182. 88476453 c.1601G>T p.G534V missense 0.00000844
183. 88466407 c.1016C>G p.A339G missense 0.00000843
184. 88476225 c.1373C>G p.A458G missense 0.00000843
185. 88441428 c.557T>C p.L186P missense 0.00000842
186. 88466388 c.997T>A p.S333T missense 0.00000840
187. 88466383 c.992C>A p.A331E missense 0.00000840
188. 88476126 c.1274G>A p.S425N missense 0.00000840
189. 88466361 c.970C>T p.P324S missense 0.00000839
190. 88466362 c.971C>T p.P324L missense 0.00000839
191. 88466305 c.914C>G p.A305G missense 0.00000839
192. 88466358 c.967C>T p.P323S missense 0.00000839
193. 88466336 c.945_972delGCTGCTGCCCGCTTCTGCCCAGCCACCT p.Ala319LeufsTer164 frameshift 0.00000838
194. 88476121 c.1269T>G p.N423K missense 0.00000838
195. 88428524 c.76C>T p.P26S missense 0.00000837
196. 88476105 c.1253C>T p.P418L missense 0.00000836
197. 88428503 c.55G>C p.G19R missense 0.00000834
198. 88476237 c.1385C>T p.T462I missense 0.00000834
199. 88428459 c.11G>A p.S4N missense 0.00000833
200. 88428479 c.31G>A p.G11R missense 0.00000833
201. 88428491 c.43T>C p.F15L missense 0.00000833
202. 88476249 c.1397C>T p.A466V missense 0.00000830
203. 88476399 c.1547G>T p.R516L missense 0.00000829
204. 88476392 c.1540C>G p.L514V missense 0.00000828
205. 88476270 c.1418C>A p.P473H missense 0.00000828
206. 88478599 c.1973A>G p.E658G missense 0.00000828
207. 88476389 c.1537A>G p.T513A missense 0.00000828
208. 88478599 c.1973A>C p.E658A missense 0.00000828
209. 88476390 c.1538C>A p.T513N missense 0.00000828
210. 88476266 c.1414G>C p.A472P missense 0.00000828
211. 88476368 c.1516delA p.Thr506ProfsTer59 frameshift 0.00000827
212. 88476279 c.1427C>T p.A476V missense 0.00000827
213. 88476291 c.1439G>A p.G480D missense 0.00000827
214. 88476290 c.1438G>A p.G480S missense 0.00000827
215. 88476366 c.1514G>A p.S505N missense 0.00000827
216. 88476317 c.1465C>T p.P489S missense 0.00000826
217. 88451789 c.826C>T p.R276C missense 0.00000826
218. 88476323 c.1471G>A p.V491M missense 0.00000826
219. 88478584 c.1958G>A p.G653E missense 0.00000826
220. 88478580 c.1954G>C p.D652H missense 0.00000826
221. 88476357 c.1505C>T p.P502L missense 0.00000826
222. 88451790 c.827G>A p.R276H missense 0.00000826
223. 88476332 c.1480G>A p.D494N missense 0.00000826
224. 88478589 c.1963C>A p.P655T missense 0.00000826
225. 88439242 c.212C>G p.S71C missense 0.00000826
226. 88439883 c.290A>G p.Q97R missense 0.00000825
227. 88477730 c.1686T>A p.F562L missense 0.00000825
228. 88439208 c.178A>T p.M60L missense 0.00000825
229. 88451781 c.818G>A p.R273H missense 0.00000825
230. 88451664 c.701T>A p.I234N missense 0.00000825
231. 88451753 c.790G>A p.A264T missense 0.00000825
232. 88451673 c.710T>G p.L237R missense 0.00000825
233. 88451759 c.796C>T p.R266C missense 0.00000825
234. 88478564 c.1938C>A p.S646R missense 0.00000825
235. 88439211 c.181A>C p.T61P missense 0.00000825
236. 88451678 c.715G>T p.V239L missense 0.00000825
237. 88451658 c.695T>G p.L232R missense 0.00000825
238. 88439214 c.184C>T p.H62Y missense 0.00000825
239. 88451763 c.800C>T p.S267F missense 0.00000825
240. 88451663 c.700A>G p.I234V missense 0.00000825
241. 88451747 c.784G>A p.E262K missense 0.00000825
242. 88439127 c.97A>T p.T33S missense 0.00000825
243. 88478545 c.1919A>G p.K640R missense 0.00000824
244. 88451741 c.778G>A p.A260T missense 0.00000824
245. 88477887 c.1843A>G p.T615A missense 0.00000824
246. 88477789 c.1745C>G p.T582S missense 0.00000824
247. 88477780 c.1736A>G p.Y579C missense 0.00000824
248. 88451707 c.744_745delTG p.Val249AspfsTer2 frameshift 0.00000824
249. 88478520 c.1894A>G p.T632A missense 0.00000824
250. 88451731 c.768_770delAGA p.Glu257del inframe 0.00000824
251. 88451696 c.733G>A p.V245I missense 0.00000824
252. 88485917 c.2002A>G p.K668E missense 0.00000824
253. 88452301 c.869C>T p.P290L missense 0.00000824
254. 88439142 c.112G>A p.A38T missense 0.00000824
255. 88477826 c.1782C>A p.N594K missense 0.00000824
256. 88451727 c.764A>G p.K255R missense 0.00000824
257. 88485977 c.2062C>T p.H688Y missense 0.00000824
258. 88478529 c.1903G>T p.V635F missense 0.00000824
259. 88477784 c.1740C>A p.C580X nonsense 0.00000824
260. 88452309 c.877G>T p.E293X nonsense 0.00000824
261. 88439166 c.136G>T p.G46C missense 0.00000824
262. 88485944 c.2029G>A p.E677K missense 0.00000824
263. 88478508 c.1882delA p.Thr628HisfsTer75 frameshift 0.00000824
264. 88478484 c.1858G>A p.E620K missense 0.00000824
265. 88478539 c.1913C>A p.A638D missense 0.00000824
266. 88477785 c.1741A>C p.K581Q missense 0.00000824
267. 88452328 c.896G>A p.S299N missense 0.00000824
268. 88439197 c.167A>G p.N56S missense 0.00000824
269. 88485964 c.2049C>G p.I683M missense 0.00000824
270. 88451705 c.742G>A p.A248T missense 0.00000824
271. 88485941 c.2026delG p.Val676TrpfsTer27 frameshift 0.00000824
272. 88451727 c.764_765insGCCAGAACAT p.Asp258HisfsTer5 frameshift 0.00000824
273. 88477833 c.1789T>C p.Y597H missense 0.00000824
274. 88477755 c.1711C>T p.H571Y missense 0.00000824
275. 88452300 c.868C>A p.P290T missense 0.00000824

* This highlights the relative frequency of the variant in the ExAC populations - Non-Finnish European, African, East Asian, South Asian, American and Finnish. Higher frequencies are denoted by darker shades of green, variants absent in a population are coloured light gray.

Genomic coordinates refer to the GRCh37 release of the human genome.