Titin Variants in Dilated Cardiomyopathy

TTN Transcript / Exon Structure & Truncating Variants in Cardiomyopathy Studies

Titin - Exon 125

Details for Exon 125 of the Titin gene - Sequence Coordinates, Associated Transcripts, Functional Data, Truncating Variants and Sequence.

The exon number is based on the LRG numbering, as recommended for clinical reporting.

Coordinates

The genomic coordinates of HG19 and Locus Reference Genomic (LRG) and the CDS coordinates of the Titin meta-transcript for exon 125 are displayed below.

HG19 Genomic		Locus Reference Genomic		Meta-Transcript
Start	End	Start	End	Start	End
179,554,100	179,554,017	146,430	146,513	31,928	32,011

Transcripts

Exon 125 occurs in the following Titin transcripts (the number indicates the exon rank of exon 125 in each transcript).

META	N2BA	N2B	N2A	NOVEX-1	NOVEX-2	NOVEX-3
124	122	-	121	-	-	-

Functional Data

Region: This exon occurs in the I-band region of the titin protein.

Domains: This exon codes for the following domain(s) - PEVK 5.

PSI: The "proportion spliced-in" (an estimate of the percentage of TTN transcripts that incorporate this exon based on RNAseq data) is 25% in DCM (LV tissue of 84 end-stage patients) and 46% in GTEx (LV tissue of 105 samples from Genotype-Tissue Expression project). (See Ref. 1 for details)

Symmetry: This exon is symmetric, i.e. the length of the exon is a multiple of three and therefore removal of it will not alter the reading frame.

References
1. A. M. Roberts, J. S. Ware, D. S. Herman et al. Integrated allelic, transcriptional, and phenomic dissection of the cardiac effects of titin truncations in health and disease. Sci. Transl. Med. 7, 270ra6 (2015).

Truncating Variants

No TTN truncating variants affecting this exon have been described in major published studies.

Sequence

Size of Exon: 84 bases Ensembl ID: ENSE00002205022

TGCCAGAAATACCAAAGAAGAAAGTTCCTGAAGAAAGGAAACCTGTTCCTCGGAAGGAGGAAGAAGTTCCACCACCACCAAAAG

ATGC = coding sequence, ATGC = non-coding sequence