Titin Variants in Dilated Cardiomyopathy

TTN Transcript / Exon Structure & Truncating Variants in Cardiomyopathy Studies

Titin - Exon 33

Details for Exon 33 of the Titin gene - Sequence Coordinates, Associated Transcripts, Functional Data, Truncating Variants and Sequence.

The exon number is based on the LRG numbering, as recommended for clinical reporting.

Coordinates

The genomic coordinates of HG19 and Locus Reference Genomic (LRG) and the CDS coordinates of the Titin meta-transcript for exon 33 are displayed below.

HG19 Genomic Locus Reference Genomic Meta-Transcript
StartEnd StartEnd StartEnd
179,638,096 179,637,836 62,434 62,6947,595 7,855

Transcripts

Exon 33 occurs in the following Titin transcripts (the number indicates the exon rank of exon 33 in each transcript).

METAN2BAN2BN2ANOVEX-1NOVEX-2NOVEX-3
33 33 32 33 32 32 33

Functional Data

Region: This exon occurs in the I-band region of the titin protein.

PSI: The "proportion spliced-in" (an estimate of the percentage of TTN transcripts that incorporate this exon based on RNAseq data) is 100% in DCM (LV tissue of 84 end-stage patients) and 100% in GTEx (LV tissue of 105 samples from Genotype-Tissue Expression project). (See Ref. 1 for details)

Symmetry: This exon is symmetric, i.e. the length of the exon is a multiple of three and therefore removal of it will not alter the reading frame.

References
1. A. M. Roberts, J. S. Ware, D. S. Herman et al. Integrated allelic, transcriptional, and phenomic dissection of the cardiac effects of titin truncations in health and disease. Sci. Transl. Med. 7, 270ra6 (2015).

Truncating Variants

No TTN truncating variants affecting this exon have been described in major published studies.

Sequence

Size of Exon: 261 bases           Ensembl ID: ENSE00002203109

AAATTAAAATTATCAGAGGTCTTCGTGACCTTACCTGTACAGAAACTCAAAATGTGGTGTTTGAGGTTGAGCTGTCCCACTCTGGAATTGATGTCCTGTGGAATTTTAAGGACAAGGAAA
TCAAGCCCAGTTCTAAATATAAAATTGAAGCACATGGAAAAATATATAAATTGACAGTTCTAAATATGATGAAAGATGATGAAGGAAAATACACATTTTACGCGGGAGAAAATATGACAT
CTGGAAAACTTACTGTGGCAG

ATGC = coding sequence, ATGC = non-coding sequence