Titin Variants in Dilated Cardiomyopathy

TTN Transcript / Exon Structure & Truncating Variants in Cardiomyopathy Studies

Titin - Exon 46

Details for Exon 46 of the Titin gene - Sequence Coordinates, Associated Transcripts, Functional Data, Truncating Variants and Sequence.

The exon number is based on the LRG numbering, as recommended for clinical reporting.

Coordinates

The genomic coordinates of HG19 and Locus Reference Genomic (LRG) and the CDS coordinates of the Titin meta-transcript for exon 46 are displayed below.

HG19 Genomic Locus Reference Genomic Meta-Transcript
StartEnd StartEnd StartEnd
179,621,524 179,620,949 79,006 79,58110,679 11,254

Transcripts

Exon 46 occurs in the following Titin transcripts (the number indicates the exon rank of exon 46 in each transcript).

METAN2BAN2BN2ANOVEX-1NOVEX-2NOVEX-3
46 - - - - 44 -

Functional Data

PSI: The "proportion spliced-in" (an estimate of the percentage of TTN transcripts that incorporate this exon based on RNAseq data) is 4% in DCM (LV tissue of 84 end-stage patients) and 14% in GTEx (LV tissue of 105 samples from Genotype-Tissue Expression project). (See Ref. 1 for details)

Symmetry: This exon is symmetric, i.e. the length of the exon is a multiple of three and therefore removal of it will not alter the reading frame.

References
1. A. M. Roberts, J. S. Ware, D. S. Herman et al. Integrated allelic, transcriptional, and phenomic dissection of the cardiac effects of titin truncations in health and disease. Sci. Transl. Med. 7, 270ra6 (2015).

Truncating Variants

The following TTN truncating variants affecting this exon have been described in major published studies (click on the study name for more details):

StudyCohortPatient IDVariant (CDS)Variant (protein)Variant Type
STM 2015HEALTHY-IC14SS01830c.10852C>Tp.Gln3618Xnonsense
STM 2015WHISRR377830c.11183dupGp.Leu3729fsframeshift
STM 2015FHS15956c.10799C>Ap.S3600*nonsense
STM 2015FHS12004c.10852C>Tp.Q3618*nonsense
STM 2015FHS11278c.11183_11184insGp.G3728fsframeshift
STM 2015JHSJ193179c.11113_11113delAp.R3705fsframeshift
STM 2015JHSJ503785c.11113_11113delAp.R3705fsframeshift

Sequence

Size of Exon: 576 bases           Ensembl ID: ENSE00001402797

TGCAAGCCCTAGATAGGCAAAGTTCTGGGAAAGATGTAAGAGAGTCCGCCAAGTCCCAGGCAGTGGCAGATTCCTCTTTCACAAAGGAGGAGAGCAAAATATCTCAAAAGGAAATTAAGT
CATTTCAAGGATCATCATATGAATATGAAGTGCAGGTTTTTGAAAGTGTATCTCAAAGTTCCATCCACACAGCTGCATCTGTTCAAGATACACAGTTGTGCCATACTGCATCCCTTTCAC
AAATTGCAGAAAGCACTGAGCTATCTAAGGAATGTGCTAAAGAGTCCACGGGTGAGGCGCCCAAGATTTTCCTGCATCTTCAGGACGTCACTGTAAAGTGCGGTGACACGGCTCAATTCC
TCTGTGTTTTAAAAGATGATTCTTTCATTGATGTAACCTGGACTCACGAAGGTGCAAAGATAGAGGAATCCGAGAGACTGAAACAATCACAAAATGGAAATATTCAGTTTCTTACCATAT
GTAATGTTCAGCTGGTAGACCAAGGACTATACAGCTGCATTGTACACAATGACTGTGGAGAGAGGACAACGTCAGCAGTACTAAGTGTAGAAGGTG

ATGC = coding sequence, ATGC = non-coding sequence