LDB3 truncating variants in ExAC


The table below lists the LDB3 truncating variants found in the ExAC population database. Click on each variant for more details, including presence in the 1000 Genomes and Exome Sequencing Project databases, a breakdown by ethnic class and the variant's role in inherited cardiac disease. Use the form below to customise the variant selection. The table can be sorted by variant location, variant type or ExAC frequency.




No. Genomic coord. Variant (CDS) Variant (Protein) Variant Type ExAC frequencyPopulations*
1. 88477842 c.1798C>T p.R600X nonsense 0.00004942
2. 88441526 c.655C>T p.R219X nonsense 0.00003486
3. 88466398 c.1007delT p.Leu336ArgfsTer156 frameshift 0.00002522
4. 88439915 c.321+1G>A essential splice site 0.00001679
5. 88477720 c.1677-1G>A essential splice site 0.00001655
6. 88441561 c.689+1G>A essential splice site 0.00000893
7. 88492668 c.2119C>T p.Q707X nonsense 0.00000892
8. 88476473 c.1621C>T p.R541X nonsense 0.00000881
9. 88469728 c.1152C>A p.Y384X nonsense 0.00000854
10. 88466336 c.945_972delGCTGCTGCCCGCTTCTGCCCAGCCACCT p.Ala319LeufsTer164 frameshift 0.00000838
11. 88476368 c.1516delA p.Thr506ProfsTer59 frameshift 0.00000827
12. 88477784 c.1740C>A p.C580X nonsense 0.00000824
13. 88451707 c.744_745delTG p.Val249AspfsTer2 frameshift 0.00000824
14. 88451727 c.764_765insGCCAGAACAT p.Asp258HisfsTer5 frameshift 0.00000824
15. 88452309 c.877G>T p.E293X nonsense 0.00000824
16. 88478508 c.1882delA p.Thr628HisfsTer75 frameshift 0.00000824
17. 88485941 c.2026delG p.Val676TrpfsTer27 frameshift 0.00000824

* This highlights the relative frequency of the variant in the ExAC populations - Non-Finnish European, African, East Asian, South Asian, American and Finnish. Higher frequencies are denoted by darker shades of green, variants absent in a population are coloured light gray.

Genomic coordinates refer to the GRCh37 release of the human genome.