Titin Variants in Dilated Cardiomyopathy

TTN Transcript / Exon Structure & Truncating Variants in Cardiomyopathy Studies

Titin - Exon 153

Details for Exon 153 of the Titin gene - Sequence Coordinates, Associated Transcripts, Functional Data, Truncating Variants and Sequence.

The exon number is based on the LRG numbering, as recommended for clinical reporting.

Coordinates

The genomic coordinates of HG19 and Locus Reference Genomic (LRG) and the CDS coordinates of the Titin meta-transcript for exon 153 are displayed below.

HG19 Genomic		HG38 Genomic		Locus Reference Genomic		Meta-Transcript
Start	End	Start	End	Start	End	Start	End
179,538,437	179,538,360	178,673,710	178,673,633	162,093	162,170	34,709	34,786

Transcripts

Exon 153 occurs in the following Titin transcripts (the number indicates the exon rank of exon 153 in each transcript).

META	N2BA	N2B	N2A	NOVEX-1	NOVEX-2	NOVEX-3
152	148	-	147	-	-	-

Functional Data

Region: This exon occurs in the I-band region of the titin protein.

PSI: The "proportion spliced-in" (an estimate of the percentage of TTN transcripts that incorporate this exon based on RNAseq data) is 48% in DCM (LV tissue of 84 end-stage patients) and 75% in GTEx (LV tissue of 105 samples from Genotype-Tissue Expression project). (See Ref. 1 for details)

Symmetry: This exon is symmetric, i.e. the length of the exon is a multiple of three and therefore removal of it will not alter the reading frame.

References
1. A. M. Roberts, J. S. Ware, D. S. Herman et al. Integrated allelic, transcriptional, and phenomic dissection of the cardiac effects of titin truncations in health and disease. Sci. Transl. Med. 7, 270ra6 (2015).

Truncating Variants

No TTN truncating variants affecting this exon have been described in major published studies.

Sequence

Size of Exon: 78 bases Ensembl ID: ENSE00002323432

TGCCTGAAGTGATTAAGAAAGCAGTACCTGAAGCACCTACTCCTGTTCCTAAAAAAGTGGAGGCACCACCAGCTAAAG

ATGC = coding sequence, ATGC = non-coding sequence