Titin Variants in Dilated Cardiomyopathy

TTN Transcript / Exon Structure & Truncating Variants in Cardiomyopathy Studies

Titin - Exon 213

Details for Exon 213 of the Titin gene - Sequence Coordinates, Associated Transcripts, Functional Data, Truncating Variants and Sequence.

The exon number is based on the LRG numbering, as recommended for clinical reporting.

Coordinates

The genomic coordinates of HG19 and Locus Reference Genomic (LRG) and the CDS coordinates of the Titin meta-transcript for exon 213 are displayed below.

HG19 Genomic		HG38 Genomic		Locus Reference Genomic		Meta-Transcript
Start	End	Start	End	Start	End	Start	End
179,514,358	179,514,281	178,649,631	178,649,554	186,172	186,249	39,896	39,973

Transcripts

Exon 213 occurs in the following Titin transcripts (the number indicates the exon rank of exon 213 in each transcript).

META	N2BA	N2B	N2A	NOVEX-1	NOVEX-2	NOVEX-3
212	-	-	-	-	-	-

Functional Data

PSI: The "proportion spliced-in" (an estimate of the percentage of TTN transcripts that incorporate this exon based on RNAseq data) is 3% in DCM (LV tissue of 84 end-stage patients) and 16% in GTEx (LV tissue of 105 samples from Genotype-Tissue Expression project). (See Ref. 1 for details)

Symmetry: This exon is symmetric, i.e. the length of the exon is a multiple of three and therefore removal of it will not alter the reading frame.

References
1. A. M. Roberts, J. S. Ware, D. S. Herman et al. Integrated allelic, transcriptional, and phenomic dissection of the cardiac effects of titin truncations in health and disease. Sci. Transl. Med. 7, 270ra6 (2015).

Truncating Variants

No TTN truncating variants affecting this exon have been described in major published studies.

Sequence

Size of Exon: 78 bases Ensembl ID: ENSE00001690572

AACCTGAGATGCCAAAGAAAGTTGTTCCAGTGAAGAAGGTCCCAACTGTTAAGAAGCCAGAAACACCAGCAGCTAAAG

ATGC = coding sequence, ATGC = non-coding sequence