Titin Variants in Dilated Cardiomyopathy

TTN Transcript / Exon Structure & Truncating Variants in Cardiomyopathy Studies

Titin - Exon 255

Details for Exon 255 of the Titin gene - Sequence Coordinates, Associated Transcripts, Functional Data, Truncating Variants and Sequence.

The exon number is based on the LRG numbering, as recommended for clinical reporting.

Coordinates

The genomic coordinates of HG19 and Locus Reference Genomic (LRG) and the CDS coordinates of the Titin meta-transcript for exon 255 are displayed below.

HG19 Genomic HG38 Genomic Locus Reference Genomic Meta-Transcript
StartEnd StartEnd StartEnd StartEnd
179,482,239 179,482,052 178,617,512 178,617,325 218,291 218,47847,573 47,760

Transcripts

Exon 255 occurs in the following Titin transcripts (the number indicates the exon rank of exon 255 in each transcript).

METAN2BAN2BN2ANOVEX-1NOVEX-2NOVEX-3
254 204 82 203 83 83 -

Functional Data

Region: This exon occurs in the A-band region of the titin protein.

Domains: This exon codes for the following domain(s) - Fibronectin type-III 3.

PSI: The "proportion spliced-in" (an estimate of the percentage of TTN transcripts that incorporate this exon based on RNAseq data) is 100% in DCM (LV tissue of 84 end-stage patients) and 86% in GTEx (LV tissue of 105 samples from Genotype-Tissue Expression project). (See Ref. 1 for details)

Symmetry: This exon is assymmetric, i.e. the length of the exon is not a multiple of three and therefore removal of it will alter the reading frame.

References
1. A. M. Roberts, J. S. Ware, D. S. Herman et al. Integrated allelic, transcriptional, and phenomic dissection of the cardiac effects of titin truncations in health and disease. Sci. Transl. Med. 7, 270ra6 (2015).

Truncating Variants

The following TTN truncating variants affecting this exon have been described in major published studies (click on the study name for more details):

StudyCohortPatient IDVariant (CDS)Variant (protein)Variant Type
STM 2015DCM-PRO10VS00240c.47697C>Ap.Cys15899Xnonsense
STM 2015DCM-REPLAP-III-4c.47692C>Tp.Arg15898*nonsense

Sequence

Size of Exon: 188 bases           Ensembl ID: ENSE00002301507

AGAGACCAAGTCCTCCTGTAAACCTAACTTCCTCAGATCAGACTCAGTCATCAGTTCAGCTCAAATGGGAACCTCCTCTGAAAGATGGAGGAAGCCCAATATTAGGCTATATAATTGAGC
GATGCGAAGAAGGAAAAGATAATTGGATTCGTTGCAATATGAAACTTGTCCCTGAACTGACTTACAAG

ATGC = coding sequence, ATGC = non-coding sequence