Titin Variants in Dilated Cardiomyopathy

TTN Transcript / Exon Structure & Truncating Variants in Cardiomyopathy Studies

Titin - Exon 27

Details for Exon 27 of the Titin gene - Sequence Coordinates, Associated Transcripts, Functional Data, Truncating Variants and Sequence.

The exon number is based on the LRG numbering, as recommended for clinical reporting.

Coordinates

The genomic coordinates of HG19 and Locus Reference Genomic (LRG) and the CDS coordinates of the Titin meta-transcript for exon 27 are displayed below.

HG19 Genomic HG38 Genomic Locus Reference Genomic Meta-Transcript
StartEnd StartEnd StartEnd StartEnd
179,642,044 179,641,876 178,777,317 178,777,149 58,486 58,6544,646 4,814

Transcripts

Exon 27 occurs in the following Titin transcripts (the number indicates the exon rank of exon 27 in each transcript).

METAN2BAN2BN2ANOVEX-1NOVEX-2NOVEX-3
27 27 26 27 26 26 27

Functional Data

Region: This exon occurs in the near Z-disk region of the titin protein.

Domains: This exon codes for the following domain(s) - Ig-like 7.

PSI: The "proportion spliced-in" (an estimate of the percentage of TTN transcripts that incorporate this exon based on RNAseq data) is 100% in DCM (LV tissue of 84 end-stage patients) and 100% in GTEx (LV tissue of 105 samples from Genotype-Tissue Expression project). (See Ref. 1 for details)

Symmetry: This exon is assymmetric, i.e. the length of the exon is not a multiple of three and therefore removal of it will alter the reading frame.

References
1. A. M. Roberts, J. S. Ware, D. S. Herman et al. Integrated allelic, transcriptional, and phenomic dissection of the cardiac effects of titin truncations in health and disease. Sci. Transl. Med. 7, 270ra6 (2015).

Truncating Variants

The following TTN truncating variants affecting this exon have been described in major published studies (click on the study name for more details):

StudyCohortPatient IDVariant (CDS)Variant (protein)Variant Type
STM 2015DCM-PRO10AP01669c.4724_4728delTGAAAp.Met1575SerfsX6frameshift

Sequence

Size of Exon: 169 bases           Ensembl ID: ENSE00002254853

CTGTGGAACATCAGGTAAAACCGATGTTTGTAGAAAAACTGAAAAATGTCAATATAAAGGAAGGTTCCCGACTTGAAATGAAAGTCAGAGCTACGGGTAACCCCAACCCTGACATTGTAT
GGTTGAAAAACAGTGACATCATTGTGCCTCATAAATATCCCAAAATCAG

ATGC = coding sequence, ATGC = non-coding sequence