Titin Variants in Dilated Cardiomyopathy

TTN Transcript / Exon Structure & Truncating Variants in Cardiomyopathy Studies

Titin - Exon 282

Details for Exon 282 of the Titin gene - Sequence Coordinates, Associated Transcripts, Functional Data, Truncating Variants and Sequence.

The exon number is based on the LRG numbering, as recommended for clinical reporting.

Coordinates

The genomic coordinates of HG19 and Locus Reference Genomic (LRG) and the CDS coordinates of the Titin meta-transcript for exon 282 are displayed below.

HG19 Genomic HG38 Genomic Locus Reference Genomic Meta-Transcript
StartEnd StartEnd StartEnd StartEnd
179,469,625 179,469,435 178,604,898 178,604,708 230,905 231,09554,191 54,381

Transcripts

Exon 282 occurs in the following Titin transcripts (the number indicates the exon rank of exon 282 in each transcript).

METAN2BAN2BN2ANOVEX-1NOVEX-2NOVEX-3
281 231 109 230 110 110 -

Functional Data

Region: This exon occurs in the A-band region of the titin protein.

Domains: This exon codes for the following domain(s) - Fibronectin type-III 19.

PSI: The "proportion spliced-in" (an estimate of the percentage of TTN transcripts that incorporate this exon based on RNAseq data) is 100% in DCM (LV tissue of 84 end-stage patients) and 93% in GTEx (LV tissue of 105 samples from Genotype-Tissue Expression project). (See Ref. 1 for details)

Symmetry: This exon is assymmetric, i.e. the length of the exon is not a multiple of three and therefore removal of it will alter the reading frame.

References
1. A. M. Roberts, J. S. Ware, D. S. Herman et al. Integrated allelic, transcriptional, and phenomic dissection of the cardiac effects of titin truncations in health and disease. Sci. Transl. Med. 7, 270ra6 (2015).

Truncating Variants

No TTN truncating variants affecting this exon have been described in major published studies.

Sequence

Size of Exon: 191 bases           Ensembl ID: ENSE00002282509

ACCGCCCATCCCCACCAAGAAATCTTGCTGTTACTGACATTAAAGCTGAATCTTGCTACTTGACATGGGATGCCCCTCTTGATAATGGTGGCAGTGAAATCACCCATTATGTTATTGACA
AACGTGATGCAAGTAGGAAGAAAGCAGAATGGGAGGAAGTCACCAACACTGCTGTAGAGAAAAGATATGGG

ATGC = coding sequence, ATGC = non-coding sequence