Titin Variants in Dilated Cardiomyopathy

TTN Transcript / Exon Structure & Truncating Variants in Cardiomyopathy Studies

Titin - Exon 294

Details for Exon 294 of the Titin gene - Sequence Coordinates, Associated Transcripts, Functional Data, Truncating Variants and Sequence.

The exon number is based on the LRG numbering, as recommended for clinical reporting.

Coordinates

The genomic coordinates of HG19 and Locus Reference Genomic (LRG) and the CDS coordinates of the Titin meta-transcript for exon 294 are displayed below.

HG19 Genomic HG38 Genomic Locus Reference Genomic Meta-Transcript
StartEnd StartEnd StartEnd StartEnd
179,462,785 179,462,635 178,598,058 178,597,908 237,745 237,89557,112 57,262

Transcripts

Exon 294 occurs in the following Titin transcripts (the number indicates the exon rank of exon 294 in each transcript).

METAN2BAN2BN2ANOVEX-1NOVEX-2NOVEX-3
293 243 121 242 122 122 -

Functional Data

Region: This exon occurs in the A-band region of the titin protein.

Domains: This exon codes for the following domain(s) - Fibronectin type-III 26.

PSI: The "proportion spliced-in" (an estimate of the percentage of TTN transcripts that incorporate this exon based on RNAseq data) is 100% in DCM (LV tissue of 84 end-stage patients) and 96% in GTEx (LV tissue of 105 samples from Genotype-Tissue Expression project). (See Ref. 1 for details)

Symmetry: This exon is assymmetric, i.e. the length of the exon is not a multiple of three and therefore removal of it will alter the reading frame.

References
1. A. M. Roberts, J. S. Ware, D. S. Herman et al. Integrated allelic, transcriptional, and phenomic dissection of the cardiac effects of titin truncations in health and disease. Sci. Transl. Med. 7, 270ra6 (2015).

Truncating Variants

The following TTN truncating variants affecting this exon have been described in major published studies (click on the study name for more details):

StudyCohortPatient IDVariant (CDS)Variant (protein)Variant Type
LMM 2014ALL-CASES114c.57215delGp.Gly19072GlufsX12frameshift

Sequence

Size of Exon: 151 bases           Ensembl ID: ENSE00002230630

GGTAAAGATAAAGAAGTGAGAGGAACAAAGCTTGTTGTGACAGGATTAAAGGAAGGAGCATTCTACAAATTTAGAGTTAGAGCAGTCAACATTGCTGGCATTGGAGAACCTGGAGAGGTC
ACAGATGTCATTGAAATGAAGGACAGACTTG

ATGC = coding sequence, ATGC = non-coding sequence