Titin Variants in Dilated Cardiomyopathy

TTN Transcript / Exon Structure & Truncating Variants in Cardiomyopathy Studies

Titin - Exon 297

Details for Exon 297 of the Titin gene - Sequence Coordinates, Associated Transcripts, Functional Data, Truncating Variants and Sequence.

The exon number is based on the LRG numbering, as recommended for clinical reporting.

Coordinates

The genomic coordinates of HG19 and Locus Reference Genomic (LRG) and the CDS coordinates of the Titin meta-transcript for exon 297 are displayed below.

HG19 Genomic HG38 Genomic Locus Reference Genomic Meta-Transcript
StartEnd StartEnd StartEnd StartEnd
179,459,373 179,459,071 178,594,646 178,594,344 241,157 241,45957,848 58,150

Transcripts

Exon 297 occurs in the following Titin transcripts (the number indicates the exon rank of exon 297 in each transcript).

METAN2BAN2BN2ANOVEX-1NOVEX-2NOVEX-3
296 246 124 245 125 125 -

Functional Data

Region: This exon occurs in the A-band region of the titin protein.

Domains: This exon codes for the following domain(s) - Fibronectin type-III 28.

PSI: The "proportion spliced-in" (an estimate of the percentage of TTN transcripts that incorporate this exon based on RNAseq data) is 100% in DCM (LV tissue of 84 end-stage patients) and 90% in GTEx (LV tissue of 105 samples from Genotype-Tissue Expression project). (See Ref. 1 for details)

Symmetry: This exon is symmetric, i.e. the length of the exon is a multiple of three and therefore removal of it will not alter the reading frame.

References
1. A. M. Roberts, J. S. Ware, D. S. Herman et al. Integrated allelic, transcriptional, and phenomic dissection of the cardiac effects of titin truncations in health and disease. Sci. Transl. Med. 7, 270ra6 (2015).

Truncating Variants

The following TTN truncating variants affecting this exon have been described in major published studies (click on the study name for more details):

StudyCohortPatient IDVariant (CDS)Variant (protein)Variant Type
PAED 2016CHILDRENUK-10c.58034_58035delCTp.T19345SfsX2frameshift
LMM 2014ALL-CASES112c.57995delAp.His19332ProfsX18frameshift
LMM 2014ALL-CASES106c.57995delAp.His19332ProfsX18frameshift
LMM 2014ALL-CASES115c.57995delAp.His19332ProfsX18frameshift
NEJM 2012DCM-CTSFDC017-253-2c.58068_58069insGp.Glu19356fsframeshift

Sequence

Size of Exon: 303 bases           Ensembl ID: ENSE00002313443

CTGTACCAGAGCGTCCTGAAGACCTGGAAGTCAAAGAAGTTACTAAAAATACTGTAACTTTGACTTGGAATCCTCCTAAGTATGATGGTGGGTCAGAAATTATTAACTATGTCCTAGAAA
GTCGGCTCATTGGGACTGAGAAGTTCCACAAAGTTACAAATGACAACTTGCTTAGCAGAAAATACACTGTTAAAGGCTTAAAAGAAGGTGATACCTATGAGTACCGTGTCAGTGCTGTCA
ACATTGTTGGACAAGGCAAACCATCATTTTGCACCAAACCAATTACTTGCAAGGATGAGCTGG

ATGC = coding sequence, ATGC = non-coding sequence