Titin Variants in Dilated Cardiomyopathy

TTN Transcript / Exon Structure & Truncating Variants in Cardiomyopathy Studies

Titin - Exon 325

Details for Exon 325 of the Titin gene - Sequence Coordinates, Associated Transcripts, Functional Data, Truncating Variants and Sequence.

The exon number is based on the LRG numbering, as recommended for clinical reporting.

Coordinates

The genomic coordinates of HG19 and Locus Reference Genomic (LRG) and the CDS coordinates of the Titin meta-transcript for exon 325 are displayed below.

HG19 Genomic HG38 Genomic Locus Reference Genomic Meta-Transcript
StartEnd StartEnd StartEnd StartEnd
179,442,237 179,441,650 178,577,510 178,576,923 258,293 258,88068,825 69,412

Transcripts

Exon 325 occurs in the following Titin transcripts (the number indicates the exon rank of exon 325 in each transcript).

METAN2BAN2BN2ANOVEX-1NOVEX-2NOVEX-3
324 274 152 273 153 153 -

Functional Data

Region: This exon occurs in the A-band region of the titin protein.

Domains: This exon codes for the following domain(s) - Ig-like 113, Fibronectin type-III 55.

PSI: The "proportion spliced-in" (an estimate of the percentage of TTN transcripts that incorporate this exon based on RNAseq data) is 100% in DCM (LV tissue of 84 end-stage patients) and 93% in GTEx (LV tissue of 105 samples from Genotype-Tissue Expression project). (See Ref. 1 for details)

Symmetry: This exon is symmetric, i.e. the length of the exon is a multiple of three and therefore removal of it will not alter the reading frame.

References
1. A. M. Roberts, J. S. Ware, D. S. Herman et al. Integrated allelic, transcriptional, and phenomic dissection of the cardiac effects of titin truncations in health and disease. Sci. Transl. Med. 7, 270ra6 (2015).

Truncating Variants

The following TTN truncating variants affecting this exon have been described in major published studies (click on the study name for more details):

StudyCohortPatient IDVariant (CDS)Variant (protein)Variant Type
STM 2015DCM-ES20PS01433c.69412+1G>Aessential splice site
NEJM 2012DCM-B UK-B2c.69412+1G>Aessential splice site

The shaded variants are from a cohort (DCM-B of the 2012 NEJM study) that was also included in the 2015 STM study (DCM-ES cohort) and therefore represent redundant mutations.

Sequence

Size of Exon: 588 bases           Ensembl ID: ENSE00002285934

AGGCACCAACAATTGTCCTTGATCCCACAATAAAAGATGGGCTAACAATTAAAGCAGGGGATACCATTGTTTTGAATGCCATTAGCATTCTTGGCAAACCCCTTCCAAAATCAAGTTGGT
CCAAGGCAGGAAAAGACATTAGACCATCAGATATCACTCAGATAACTTCAACCCCAACATCTTCCATGCTTACTATCAAGTATGCCACTAGAAAAGATGCGGGTGAATATACCATCACTG
CTACCAATCCTTTTGGCACGAAGGTGGAACATGTGAAGGTAACAGTCCTTGATGTACCTGGTCCCCCAGGTCCTGTTGAAATCAGTAATGTTTCTGCTGAAAAAGCAACACTTACATGGA
CACCTCCCTTGGAAGATGGCGGCTCACCAATTAAGTCCTATATACTTGAAAAGAGAGAAACCAGCCGACTTTTGTGGACAGTGGTTTCTGAAGATATTCAGTCTTGCAGGCATGTGGCAA
CCAAACTTATCCAAGGAAATGAGTACATCTTCCGGGTCTCAGCTGTAAACCACTATGGCAAAGGAGAACCTGTACAGTCTGAACCTGTCAAAATGGTAGACAGATTTG

ATGC = coding sequence, ATGC = non-coding sequence