Titin Variants in Dilated Cardiomyopathy

TTN Transcript / Exon Structure & Truncating Variants in Cardiomyopathy Studies

Titin - Exon 328

Details for Exon 328 of the Titin gene - Sequence Coordinates, Associated Transcripts, Functional Data, Truncating Variants and Sequence.

The exon number is based on the LRG numbering, as recommended for clinical reporting.

Coordinates

The genomic coordinates of HG19 and Locus Reference Genomic (LRG) and the CDS coordinates of the Titin meta-transcript for exon 328 are displayed below.

HG19 Genomic HG38 Genomic Locus Reference Genomic Meta-Transcript
StartEnd StartEnd StartEnd StartEnd
179,423,364 179,423,068 178,558,637 178,558,341 277,166 277,46286,822 87,118

Transcripts

Exon 328 occurs in the following Titin transcripts (the number indicates the exon rank of exon 328 in each transcript).

METAN2BAN2BN2ANOVEX-1NOVEX-2NOVEX-3
327 277 155 276 156 156 -

Functional Data

Region: This exon occurs in the A-band region of the titin protein.

Domains: This exon codes for the following domain(s) - Fibronectin type-III 99.

PSI: The "proportion spliced-in" (an estimate of the percentage of TTN transcripts that incorporate this exon based on RNAseq data) is 100% in DCM (LV tissue of 84 end-stage patients) and 96% in GTEx (LV tissue of 105 samples from Genotype-Tissue Expression project). (See Ref. 1 for details)

Symmetry: This exon is symmetric, i.e. the length of the exon is a multiple of three and therefore removal of it will not alter the reading frame.

References
1. A. M. Roberts, J. S. Ware, D. S. Herman et al. Integrated allelic, transcriptional, and phenomic dissection of the cardiac effects of titin truncations in health and disease. Sci. Transl. Med. 7, 270ra6 (2015).

Truncating Variants

The following TTN truncating variants affecting this exon have been described in major published studies (click on the study name for more details):

StudyCohortPatient IDVariant (CDS)Variant (protein)Variant Type
STM 2015DCM-PRO12JL00046c.86967G>Ap.Trp28989Xnonsense

Sequence

Size of Exon: 297 bases           Ensembl ID: ENSE00001124292

AAAAACCAAGCCCACCTGAAAAACTTGGAGTAACAAGTATATCCAAAGACAGTGTTTCCCTGACCTGGCTGAAGCCTGAACATGATGGCGGAAGCAGAATTGTACACTATGTCGTTGAAG
CACTAGAAAAAGGACAGAAAAACTGGGTTAAATGTGCAGTGGCAAAGTCAACCCATCACGTTGTTTCCGGTCTGAGAGAGAATTCTGAATACTTTTTCCGAGTGTTTGCTGAAAATCAAG
CTGGCCTGAGTGACCCGAGAGAGCTTCTGCTTCCTGTTCTTATTAAGGAGCAACTAG

ATGC = coding sequence, ATGC = non-coding sequence