Titin Variants in Dilated Cardiomyopathy

TTN Transcript / Exon Structure & Truncating Variants in Cardiomyopathy Studies

Titin - Exon 334

Details for Exon 334 of the Titin gene - Sequence Coordinates, Associated Transcripts, Functional Data, Truncating Variants and Sequence.

The exon number is based on the LRG numbering, as recommended for clinical reporting.

Coordinates

The genomic coordinates of HG19 and Locus Reference Genomic (LRG) and the CDS coordinates of the Titin meta-transcript for exon 334 are displayed below.

HG19 Genomic HG38 Genomic Locus Reference Genomic Meta-Transcript
StartEnd StartEnd StartEnd StartEnd
179,418,943 179,418,641 178,554,216 178,553,914 281,587 281,88988,895 89,197

Transcripts

Exon 334 occurs in the following Titin transcripts (the number indicates the exon rank of exon 334 in each transcript).

METAN2BAN2BN2ANOVEX-1NOVEX-2NOVEX-3
333 283 161 282 162 162 -

Functional Data

Region: This exon occurs in the A-band region of the titin protein.

Domains: This exon codes for the following domain(s) - Fibronectin type-III 104.

PSI: The "proportion spliced-in" (an estimate of the percentage of TTN transcripts that incorporate this exon based on RNAseq data) is 100% in DCM (LV tissue of 84 end-stage patients) and 97% in GTEx (LV tissue of 105 samples from Genotype-Tissue Expression project). (See Ref. 1 for details)

Symmetry: This exon is symmetric, i.e. the length of the exon is a multiple of three and therefore removal of it will not alter the reading frame.

References
1. A. M. Roberts, J. S. Ware, D. S. Herman et al. Integrated allelic, transcriptional, and phenomic dissection of the cardiac effects of titin truncations in health and disease. Sci. Transl. Med. 7, 270ra6 (2015).

Truncating Variants

The following TTN truncating variants affecting this exon have been described in major published studies (click on the study name for more details):

StudyCohortPatient IDVariant (CDS)Variant (protein)Variant Type
LMM 2014ALL-CASES105c.89197_89197+2delGGTessential splice site

Sequence

Size of Exon: 303 bases           Ensembl ID: ENSE00001075042

TTACACCTGGGCCACCAGGCATACCAGAAGTGACAAAGATTACCAAGAATTCGATGACTGTTGTATGGAGCAGGCCAATTGCAGATGGCGGTAGTGATATAAGTGGCTATTTCCTTGAAA
AACGAGACAAGAAGAGCCTAGGATGGTTTAAAGTACTAAAAGAGACTATCCGTGACACCAGACAAAAAGTAACAGGACTCACAGAAAACAGTGACTATCAATACAGAGTTTGTGCTGTAA
ACGCTGCTGGACAGGGTCCATTTTCTGAACCATCTGAATTCTACAAAGCTGCTGATCCTATTG

ATGC = coding sequence, ATGC = non-coding sequence