Titin Variants in Dilated Cardiomyopathy

TTN Transcript / Exon Structure & Truncating Variants in Cardiomyopathy Studies

Titin - Exon 348

Details for Exon 348 of the Titin gene - Sequence Coordinates, Associated Transcripts, Functional Data, Truncating Variants and Sequence.

The exon number is based on the LRG numbering, as recommended for clinical reporting.

Coordinates

The genomic coordinates of HG19 and Locus Reference Genomic (LRG) and the CDS coordinates of the Titin meta-transcript for exon 348 are displayed below.

HG19 Genomic HG38 Genomic Locus Reference Genomic Meta-Transcript
StartEnd StartEnd StartEnd StartEnd
179,408,389 179,407,796 178,543,662 178,543,069 292,141 292,73496,311 96,904

Transcripts

Exon 348 occurs in the following Titin transcripts (the number indicates the exon rank of exon 348 in each transcript).

METAN2BAN2BN2ANOVEX-1NOVEX-2NOVEX-3
347 297 175 296 176 176 -

Functional Data

Region: This exon occurs in the A-band region of the titin protein.

Domains: This exon codes for the following domain(s) - Fibronectin type-III 122/123.

PSI: The "proportion spliced-in" (an estimate of the percentage of TTN transcripts that incorporate this exon based on RNAseq data) is 100% in DCM (LV tissue of 84 end-stage patients) and 99% in GTEx (LV tissue of 105 samples from Genotype-Tissue Expression project). (See Ref. 1 for details)

Symmetry: This exon is symmetric, i.e. the length of the exon is a multiple of three and therefore removal of it will not alter the reading frame.

References
1. A. M. Roberts, J. S. Ware, D. S. Herman et al. Integrated allelic, transcriptional, and phenomic dissection of the cardiac effects of titin truncations in health and disease. Sci. Transl. Med. 7, 270ra6 (2015).

Truncating Variants

The following TTN truncating variants affecting this exon have been described in major published studies (click on the study name for more details):

StudyCohortPatient IDVariant (CDS)Variant (protein)Variant Type
STM 2015DCM-ES20PA01474c.96460_96461insAp.T32154fsframeshift
STM 2015WHISRR363326c.96892C>Tp.Gln32298*nonsense
NEJM 2012DCM-B UK-E4c.96460_96461insAp.Thr32154fsframeshift

The shaded variants are from a cohort (DCM-B of the 2012 NEJM study) that was also included in the 2015 STM study (DCM-ES cohort) and therefore represent redundant mutations.

Sequence

Size of Exon: 594 bases           Ensembl ID: ENSE00001387777

ATACTCCTGGTCCCTGTCCTTCAGTGAAAGTTAAGGAAGTATCAAGAGATTCTGTGACTATAACTTGGGAAATTCCCACGATTGATGGTGGAGCTCCAGTCAACAATTACATCGTTGAGA
AGCGTGAAGCTGCTATGAGAGCATTCAAAACAGTAACTACCAAATGCAGCAAGACACTTTACAGAATTTCTGGACTTGTAGAAGGAACCATGTACTATTTCAGAGTGCTGCCAGAAAATA
TTTATGGCATTGGAGAACCTTGTGAAACATCTGATGCAGTACTGGTCTCAGAAGTGCCTTTGGTGCCTGCAAAGCTAGAAGTGGTCGATGTCACCAAATCCACTGTTACCCTTGCCTGGG
AAAAACCACTCTACGATGGTGGTAGCCGACTCACTGGATATGTTCTCGAGGCCTGCAAAGCTGGCACAGAGAGATGGATGAAGGTTGTCACCTTAAAACCCACAGTCCTAGAGCACACTG
TTACTTCCTTAAATGAAGGTGAACAATACTTATTTAGAATAAGGGCACAAAATGAGAAAGGTGTGTCAGAACCAAGAGAGACTGTCACAGCCGTGACTGTACAAGACCTCAGAG

ATGC = coding sequence, ATGC = non-coding sequence