Titin Variants in Dilated Cardiomyopathy
TTN Transcript / Exon Structure & Truncating Variants in Cardiomyopathy Studies
Titin - Exon 46
Details for Exon 46 of the Titin gene - Sequence Coordinates, Associated Transcripts, Functional Data, Truncating Variants and Sequence.
Coordinates
The genomic coordinates of HG19 and Locus Reference Genomic (LRG) and the CDS coordinates of the Titin meta-transcript for exon 46 are displayed below.
| HG19 Genomic | HG38 Genomic | Locus Reference Genomic | Meta-Transcript | ||||
|---|---|---|---|---|---|---|---|
| Start | End | Start | End | Start | End | Start | End |
| 179,621,524 | 179,620,949 | 178,756,797 | 178,756,222 | 79,006 | 79,581 | 10,679 | 11,254 |
Transcripts
Exon 46 occurs in the following Titin transcripts (the number indicates the exon rank of exon 46 in each transcript).
| META | N2BA | N2B | N2A | NOVEX-1 | NOVEX-2 | NOVEX-3 |
| 46 | - | - | - | - | 44 | - |
Functional Data
PSI: The "proportion spliced-in" (an estimate of the percentage of TTN transcripts that incorporate this exon based on RNAseq data) is 4% in DCM (LV tissue of 84 end-stage patients) and 14% in GTEx (LV tissue of 105 samples from Genotype-Tissue Expression project). (See Ref. 1 for details)
Symmetry: This exon is symmetric, i.e. the length of the exon is a multiple of three and therefore removal of it will not alter the reading frame.
References
1. A. M. Roberts, J. S. Ware, D. S. Herman et al.
Integrated allelic, transcriptional, and phenomic dissection of the cardiac effects of titin truncations in health and disease.
Sci. Transl. Med. 7, 270ra6 (2015).
Truncating Variants
The following TTN truncating variants affecting this exon have been described in major published studies (click on the study name for more details):
| Study | Cohort | Patient ID | Variant (CDS) | Variant (protein) | Variant Type |
|---|---|---|---|---|---|
| STM 2015 | HEALTHY-IC | 14SS01830 | c.10852C>T | p.Gln3618X | nonsense |
| STM 2015 | WHI | SRR377830 | c.11183dupG | p.Leu3729fs | frameshift |
| STM 2015 | FHS | 15956 | c.10799C>A | p.S3600* | nonsense |
| STM 2015 | FHS | 12004 | c.10852C>T | p.Q3618* | nonsense |
| STM 2015 | FHS | 11278 | c.11183_11184insG | p.G3728fs | frameshift |
| STM 2015 | JHS | J193179 | c.11113_11113delA | p.R3705fs | frameshift |
| STM 2015 | JHS | J503785 | c.11113_11113delA | p.R3705fs | frameshift |
Sequence
Size of Exon: 576 bases
Ensembl ID:
ENSE00001402797
CATTTCAAGGATCATCATATGAATATGAAGTGCAGGTTTTTGAAAGTGTATCTCAAAGTTCCATCCACACAGCTGCATCTGTTCAAGATACACAGTTGTGCCATACTGCATCCCTTTCAC
AAATTGCAGAAAGCACTGAGCTATCTAAGGAATGTGCTAAAGAGTCCACGGGTGAGGCGCCCAAGATTTTCCTGCATCTTCAGGACGTCACTGTAAAGTGCGGTGACACGGCTCAATTCC
TCTGTGTTTTAAAAGATGATTCTTTCATTGATGTAACCTGGACTCACGAAGGTGCAAAGATAGAGGAATCCGAGAGACTGAAACAATCACAAAATGGAAATATTCAGTTTCTTACCATAT
GTAATGTTCAGCTGGTAGACCAAGGACTATACAGCTGCATTGTACACAATGACTGTGGAGAGAGGACAACGTCAGCAGTACTAAGTGTAGAAGGTG
ATGC = coding sequence, ATGC = non-coding sequence
