Titin Variants in Dilated Cardiomyopathy
TTN Transcript / Exon Structure & Truncating Variants in Cardiomyopathy Studies
Titin - Exon 6
Details for Exon 6 of the Titin gene - Sequence Coordinates, Associated Transcripts, Functional Data, Truncating Variants and Sequence.
Coordinates
The genomic coordinates of HG19 and Locus Reference Genomic (LRG) and the CDS coordinates of the Titin meta-transcript for exon 6 are displayed below.
| HG19 Genomic | HG38 Genomic | Locus Reference Genomic | Meta-Transcript | ||||
|---|---|---|---|---|---|---|---|
| Start | End | Start | End | Start | End | Start | End |
| 179,664,458 | 179,664,214 | 178,799,731 | 178,799,487 | 36,072 | 36,316 | 670 | 914 |
Transcripts
Exon 6 occurs in the following Titin transcripts (the number indicates the exon rank of exon 6 in each transcript).
| META | N2BA | N2B | N2A | NOVEX-1 | NOVEX-2 | NOVEX-3 |
| 6 | 6 | 6 | 6 | 6 | 6 | 6 |
Functional Data
Region: This exon occurs in the Z-disk region of the titin protein.
PSI: The "proportion spliced-in" (an estimate of the percentage of TTN transcripts that incorporate this exon based on RNAseq data) is 100% in DCM (LV tissue of 84 end-stage patients) and 100% in GTEx (LV tissue of 105 samples from Genotype-Tissue Expression project). (See Ref. 1 for details)
Symmetry: This exon is assymmetric, i.e. the length of the exon is not a multiple of three and therefore removal of it will alter the reading frame.
References
1. A. M. Roberts, J. S. Ware, D. S. Herman et al.
Integrated allelic, transcriptional, and phenomic dissection of the cardiac effects of titin truncations in health and disease.
Sci. Transl. Med. 7, 270ra6 (2015).
Truncating Variants
No TTN truncating variants affecting this exon have been described in major published studies.
Sequence
Size of Exon: 245 bases
Ensembl ID:
ENSE00002209922
AGATCCCCAACACCACCGTCTATTGCTGCCAAAGCACAGCTGGCTCGGCAGCAGTCCCCATCGCCCATAAGACACTCCCCTTCCCCGGTCAGACACGTGCGGGCACCGACCCCATCTCCG
GTCAG
ATGC = coding sequence, ATGC = non-coding sequence
